Home / Products /Genome Editing /gRNA plasmids /hIPO4 gRNA1 KO plasmidhIPO4 gRNA2 KO plasmid

hIPO4 gRNA1 KO plasmidhIPO4 gRNA2 KO plasmid

Catalog Number: GP04990

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hIPO4 gRNA1 KO plasmidhIPO4 gRNA2 KO plasmid
gRNA sequence CGACGGATGCGCTCGGTGTCCGG(96,0.77),CGGGCTAGAGCAGCTCCTACGGG(81,0.7)
Gene hIPO4
Gene ID 79711
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.