Home / Products /Genome Editing /gRNA plasmids /hHPS5 gRNA1 KO plasmidhHPS5 gRNA2 KO plasmidhHPS5 gRNA3 KO plasmid

hHPS5 gRNA1 KO plasmidhHPS5 gRNA2 KO plasmidhHPS5 gRNA3 KO plasmid

Catalog Number: GP08150

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHPS5 gRNA1 KO plasmidhHPS5 gRNA2 KO plasmidhHPS5 gRNA3 KO plasmid
gRNA sequence GAATTAAATCAAGAGCGTCGTGG(97,0.78),TTTTTGTAGGTGATCATGCTGGG(63,0.71),AAGAGTCACAGCTCTCTGCTGGG(61,0.63)
Gene hHPS5
Gene ID 11234
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.