Home / Products /Genome Editing /gRNA plasmids /hHMG20B gRNA1 KO plasmidhHMG20B gRNA2 KO plasmidhHMG20B gRNA3 KO plasmid

hHMG20B gRNA1 KO plasmidhHMG20B gRNA2 KO plasmidhHMG20B gRNA3 KO plasmid

Catalog Number: GP05065

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHMG20B gRNA1 KO plasmidhHMG20B gRNA2 KO plasmidhHMG20B gRNA3 KO plasmid
gRNA sequence TGTCAAGCAAGAGCGCGGCGAGG(95,0.75),GGTCCACGCGCGGGCGAGAAGGG(94,0.66),TCACCACGAAGCCCCCATGCTGG(81,0.72)
Gene hHMG20B
Gene ID 10362
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.