Home / Products /Genome Editing /gRNA plasmids /hGDA gRNA1 KO plasmidhGDA gRNA2 KO plasmidhGDA gRNA3 KO plasmid

hGDA gRNA1 KO plasmidhGDA gRNA2 KO plasmidhGDA gRNA3 KO plasmid

Catalog Number: GP05167

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGDA gRNA1 KO plasmidhGDA gRNA2 KO plasmidhGDA gRNA3 KO plasmid
gRNA sequence TGGAGTGGACGAACGTCCCTCGG(94,0.71),TGCCGCTGTCGCTCACGCCGAGG(91,0.74),TGCCGCTCAGATGCCGCCCCTGG(80,0.74)
Gene hGDA
Gene ID 9615
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.