Home / Products /Genome Editing /gRNA plasmids /hGBP4 gRNA1 KO plasmidhGBP4 gRNA2 KO plasmidhGBP4 gRNA3 KO plasmid

hGBP4 gRNA1 KO plasmidhGBP4 gRNA2 KO plasmidhGBP4 gRNA3 KO plasmid

Catalog Number: GP05172

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGBP4 gRNA1 KO plasmidhGBP4 gRNA2 KO plasmidhGBP4 gRNA3 KO plasmid
gRNA sequence ATTGTAGGGCTATACCGCACAGG(95,0.8),GATGGCCCCCATTTGTCTAGTGG(88,0.86),CAAGATTTCTCAGCCCGTGGTGG(85,0.78)
Gene hGBP4
Gene ID 115361
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.