Home / Products /Genome Editing /gRNA plasmids /hFUS gRNA1 KO plasmidhFUS gRNA2 KO plasmidhFUS gRNA3 KO plasmid

hFUS gRNA1 KO plasmidhFUS gRNA2 KO plasmidhFUS gRNA3 KO plasmid

Catalog Number: GP05197

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFUS gRNA1 KO plasmidhFUS gRNA2 KO plasmidhFUS gRNA3 KO plasmid
gRNA sequence ACTGTAACTCTGCTGTCCGTAGG(91,0.8),AGCCTGAAGTGTCCGTGGACTGG(90,0.7),GGAATAGCCCTGCCCGGGCTGGG(78,0.71)
Gene hFUS
Gene ID 2521
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.