Home / Products /Genome Editing /gRNA plasmids /hFHL gRNA1 KO plasmidhFHL gRNA2 KO plasmidhFHL gRNA3 KO plasmid

hFHL gRNA1 KO plasmidhFHL gRNA2 KO plasmidhFHL gRNA3 KO plasmid

Catalog Number: GP05229

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFHL gRNA1 KO plasmidhFHL gRNA2 KO plasmidhFHL gRNA3 KO plasmid
gRNA sequence GGATGTACTTGCGTCCATACAGG(97,0.72),AGCTTATCGGGCATGACTCGAGG(97,0.74),AGTAGGGGCCGCTGTCTGTCTGG(65,0.66)
Gene hFHL
Gene ID 2275
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.