Home / Products /Genome Editing /gRNA plasmids /hDDB2 gRNA1 KO plasmidhDDB2 gRNA2 KO plasmidhDDB2 gRNA3 KO plasmid

hDDB2 gRNA1 KO plasmidhDDB2 gRNA2 KO plasmidhDDB2 gRNA3 KO plasmid

Catalog Number: GP05412

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hDDB2 gRNA1 KO plasmidhDDB2 gRNA2 KO plasmidhDDB2 gRNA3 KO plasmid
gRNA sequence CTGACGATGCTGCGGCATGGTGG(87,0.67),AAGCTCTGCCCAGCTTATGCTGG(83,0.78),GATGTGACTCAGACTGCCTCTGG(71,0.82)
Gene hDDB2
Gene ID 1643
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.