Home / Products /Genome Editing /gRNA plasmids /hDAPK1 gRNA1 KO plasmidhDAPK1 gRNA2 KO plasmidhDAPK1 gRNA3 KO plasmid

hDAPK1 gRNA1 KO plasmidhDAPK1 gRNA2 KO plasmidhDAPK1 gRNA3 KO plasmid

Catalog Number: GP05420

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hDAPK1 gRNA1 KO plasmidhDAPK1 gRNA2 KO plasmidhDAPK1 gRNA3 KO plasmid
gRNA sequence TGATGAATTTGGCGGCATACTGG(95,0.66),TGTTCTCATAGACCTCGTGCAGG(94,0.67),CCTCCCGCTCGATGTCCTCGCGG(93,0.75)
Gene hDAPK1
Gene ID 1612
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.