Home / Products /Genome Editing /gRNA plasmids /hCTSB gRNA1 KO plasmidhCTSB gRNA2 KO plasmidhCTSB gRNA3 KO plasmid

hCTSB gRNA1 KO plasmidhCTSB gRNA2 KO plasmidhCTSB gRNA3 KO plasmid

Catalog Number: GP05431

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCTSB gRNA1 KO plasmidhCTSB gRNA2 KO plasmidhCTSB gRNA3 KO plasmid
gRNA sequence AGTTGACCAGCTCATCCGACAGG(92,0.68),TGTTGGCCAATGCCCGGAGCAGG(85,0.74),TCAACAAACGGAATACCACGTGG(92,0.6)
Gene hCTSB
Gene ID 1508
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.