Home / Products /Genome Editing /gRNA plasmids /hCNOT7 gRNA1 KO plasmidhCNOT7 gRNA2 KO plasmid

hCNOT7 gRNA1 KO plasmidhCNOT7 gRNA2 KO plasmid

Catalog Number: GP05511

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCNOT7 gRNA1 KO plasmidhCNOT7 gRNA2 KO plasmid
gRNA sequence CTATGATCTACAGTTGCCGCTGG(71,0.73),GGTGTGGTTGCAAGACCCATTGG(61,0.67)
Gene hCNOT7
Gene ID 29883
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.