Home / Products /Genome Editing /gRNA plasmids /hCHUK gRNA1 KO plasmidhCHUK gRNA2 KO plasmidhCHUK gRNA3 KO plasmid

hCHUK gRNA1 KO plasmidhCHUK gRNA2 KO plasmidhCHUK gRNA3 KO plasmid

Catalog Number: GP08130

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCHUK gRNA1 KO plasmidhCHUK gRNA2 KO plasmidhCHUK gRNA3 KO plasmid
gRNA sequence ACAGACGTTCCCGAAGCCGCCGG(95,0.64),GTACCAAAAACAGAGAACGATGG(71,0.71),GAACCATGCCAATGTTGTAAAGG(81,0.66)
Gene hCHUK
Gene ID 1147
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.