Home / Products /Genome Editing /gRNA plasmids /hCERS2 gRNA1 KO plasmidhCERS2 gRNA2 KO plasmidhCERS2 gRNA3 KO plasmid

hCERS2 gRNA1 KO plasmidhCERS2 gRNA2 KO plasmidhCERS2 gRNA3 KO plasmid

Catalog Number: GP05547

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCERS2 gRNA1 KO plasmidhCERS2 gRNA2 KO plasmidhCERS2 gRNA3 KO plasmid
gRNA sequence TCGGTCTTCTAGATCGGCCCAGG(96,0.74),TCTCTATATCACGCTGCCCCTGG(86,0.75),CCACCAGAAGTAATCATACAAGG(83,0.66)
Gene hCERS2
Gene ID 29956
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.