Home / Products /Genome Editing /gRNA plasmids /hC20orf27 gRNA1 KO plasmidhC20orf27 gRNA2 KO plasmid

hC20orf27 gRNA1 KO plasmidhC20orf27 gRNA2 KO plasmid

Catalog Number: GP05661

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hC20orf27 gRNA1 KO plasmidhC20orf27 gRNA2 KO plasmid
gRNA sequence AAAGCGGATACTCCGGACTCTGG(93,0.73),TGTGGGATCCTTCTGCATCGTGG(81,0.87)
Gene hC20orf27
Gene ID 54976
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.