Home / Products /Genome Editing /gRNA plasmids /hATP13A3 gRNA1 KO plasmidhATP13A3 gRNA2 KO plasmidhATP13A3 gRNA3 KO plasmid

hATP13A3 gRNA1 KO plasmidhATP13A3 gRNA2 KO plasmidhATP13A3 gRNA3 KO plasmid

Catalog Number: GP05739

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hATP13A3 gRNA1 KO plasmidhATP13A3 gRNA2 KO plasmidhATP13A3 gRNA3 KO plasmid
gRNA sequence GCCACTCAGGCATCCAATAGAGG(86,0.71),TCTTTAGGAGTGATTTGCTCTGG(69,0.73),ACTGTGAAGTAGTGCTGCTGAGG(64,0.8)
Gene hATP13A3
Gene ID 79572
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.